Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

نویسندگان

  • H Shi
  • Z Zhang
  • X Wang
  • S Liu
  • C T Teng
چکیده

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Isolation and Sequence Analysis of GpdII Promoter of the White Button Mushroom (Agaricus bisporus) from Strains Holland737 and IM008

Many recent studies have shown that glycosylation patterns of Agaricus bisporus are similar to those of mammalians, so that this organism is a good candidate for the expression of glycosylated pharmaceutical protein. To achieve constant interested gene expression in all cells of the organism, proper promoter isolation is necessary. To isolate this promoter, PCR with specific primers was perform...

متن کامل

P-127: Characterization of Filia, A Maternal Effect Gene, in Bovine Oocytes and Embryos

Background: Genetic analysis in mice has lead to find about maternal effect genes such as Filia. Filia knock out mice have a 50% decrease in fertility. Filia dysfunction causes disorders in pre-implantation development. Mutations in human Filia gene, cause FBHM (Familial Biparental Hydatidiform Mole) in women. Filia protein in mice is homologous to that of rat and human, so this idea has emerge...

متن کامل

Characterization of estrogen-responsive mouse lactoferrin promoter.

Mouse lactoferrin is expressed in a variety of tissues under different types of control. To understand how molecular mechanisms govern the mode of lactoferrin expression, we isolated and characterized the 5'-flanking region of the lactoferrin gene. Several clones containing lactoferrin gene fragments were isolated from a mouse (129/J) genomic library including clone lambda J14, which contains a...

متن کامل

P-70: Study of GTn-Repeat Expansion in Heme Oxygenase-1 Gene Promoter As Genetic Cause of Male Infertility

Background: The length of GT-repeats polymorphic region in the promoter of human Heme oxygenase-1 gene (HO-1) alters the level of its transcriptional activity in response to oxidative stresses. Decreased level of HO-1 protein in the seminal plasma has been reported to be associated with oligospermia and azoospermia in male infertility. This is the first study to investigate the association betw...

متن کامل

Bioinformatic and empirical analysis of a gene encoding serine/threonine protein kinase regulated in response to chemical and biological fertilizers in two maize (Zea mays L.) cultivars

Molecular structure of a gene, ZmSTPK1, encoding a serine/threonine protein kinase in maize was analyzed by bioinformatic tool and its expression pattern was studied under chemical biological fertilizers. Bioinformatic analysis cleared that ZmSTPK1 is located on chromosome 10, from position 141015332 to 141017582. The full genomic sequence of the gene is 2251 bp in length and includes 2 exons. ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Nucleic acids research

دوره 27 24  شماره 

صفحات  -

تاریخ انتشار 1999